Top » Catalog » SNPs » A247

$18.00

A247
[A247]

A247
hg38 Position: ChrY:9948111..9948111
Ancestral: T
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1j~
Comments: Downstream R1b-Z251
Forward Primer: A247_F GCATCAATCATTATGTATTATTTACAAATCTG
Reverse Primer: A247_R TGCATAAATATTTTAATTTATCTTTTTAACACTTC
Reviews

Customers who bought this product also purchased
A228
A228
A254
A254
A241
A241
FGC13933
FGC13933
A246
A246
R1b-Z251 downstream 24
R1b-Z251 downstream 24
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies