Top » Catalog » SNPs » A251

$18.00

A251
[A251]

A251
hg38 Position: ChrY:13352954..13352954
Ancestral: A
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A251_F TGAAGGCCAAGGAAAGTAAAAC
Reverse Primer: A251_R GAGGCCTTGAAACCAGGTG
Reviews

Customers who bought this product also purchased
A244
A244
A250
A250
A230
A230
A256
A256
A243
A243
A248
A248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies