Top » Catalog » SNPs » A253

$18.00

A253
[A253]

A253
hg38 Position: ChrY:17355297..17355297
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A253_F TGGGGTTAGTTTCCCACAAG
Reverse Primer: A253_R TTTCTCATTACTGGAGGCTTTTC
Reviews

Customers who bought this product also purchased
A228
A228
A254
A254
A241
A241
FGC13933
FGC13933
A246
A246
R1b-Z251 downstream 24
R1b-Z251 downstream 24
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies