Top » Catalog » SNPs » A254

$18.00

A254
[A254]

A254
hg38 Position: ChrY:17451695..17451695
Ancestral: C
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A254_F ATGGACTCAGGGGAGAAAGG
Reverse Primer: A254_R ATGGTGGCTACTGGGATTTC
Reviews

Customers who bought this product also purchased
FGC13933
FGC13933
A241
A241
A246
A246
R1b-Z251 downstream 24
R1b-Z251 downstream 24
A252
A252
FGC13909
FGC13909
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies