Top » Catalog » SNPs » A255

$18.00

A255
[A255]

A255
hg38 Position: ChrY:18917512..18917512
Ancestral: A
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A255_F TAAGTCCTGCTCCAGGCATC
Reverse Primer: A255_R GGGCAGGACAATTGGAAG
Reviews

Customers who bought this product also purchased
A247
A247
A228
A228
A253
A253
A241
A241
FGC13933
FGC13933
A246
A246
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies