Top » Catalog » SNPs » A259

$19.00

A259
[A259]

A259
hg38 Position: ChrY:15557160..15557160
Ancestral: A
Derived: G
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a3
Comments: Downstream R1b-M222/S660
Forward Primer: A259_F CAAAAATGACCCTGGGCTTC
Reverse Primer: A259_R GGCATCACAGTGTTCAAAATG
Reviews

Customers who bought this product also purchased
A1332
A1332
FGC49692
FGC49692
BY38401
BY38401
BY100917
BY100917
FT101173
FT101173
FGC34296
FGC34296
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies