Top » Catalog » SNPs » A259

$18.00

A259
[A259]

A259
hg38 Position: ChrY:15557160..15557160
Ancestral: A
Derived: G
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a3
Comments: Downstream R1b-M222/S660
Forward Primer: A259_F CAAAAATGACCCTGGGCTTC
Reverse Primer: A259_R GGCATCACAGTGTTCAAAATG
Reviews

Customers who bought this product also purchased
A984
A984
A10528
A10528
FGC19845
FGC19845
A4697
A4697
BY18130
BY18130
BY11697
BY11697
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies