Top » Catalog » SNPs » A260

$18.00

A260
[A260]

A260
hg38 Position: ChrY:20699651..20699651
Ancestral: G
Derived: A
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a3a
Comments: Downstream R1b-M222/S660
Forward Primer: A260_F CTGGGCAGTCATTACAGCAG
Reverse Primer: A260_R TGCCACTTTCATATGCCTTG
Reviews

Customers who bought this product also purchased
M9
M9
L1193
L1193
M223
M223
S9403
S9403
M343
M343
L126
L126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies