Top » Catalog » SNPs » CTS9686

$18.00

CTS9686
[CTS9686]

CTS9686
hg38 Position: ChrY:16911439..16911439
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Extracted from 1000 genomes data. Downstream R1b-Z251
Forward Primer: CTS9686_F GATGGTTTCCTCCATGCTG
Reverse Primer: CTS9686_R TTGTGTAAACTCTGCTTGAGTGG
Reviews

Customers who bought this product also purchased
DF13
DF13
FGC11134
FGC11134
FGC5494
FGC5494
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
L513
L513
Z251
Z251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies