Top » Catalog » SNPs » CTS9686

$18.00

CTS9686
[CTS9686]

CTS9686
hg38 Position: ChrY:16911439..16911439
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Extracted from 1000 genomes data. Downstream R1b-Z251
Forward Primer: CTS9686_F GATGGTTTCCTCCATGCTG
Reverse Primer: CTS9686_R TTGTGTAAACTCTGCTTGAGTGG
Reviews

Customers who bought this product also purchased
L513
L513
Z251
Z251
A551
A551
DF21
DF21
DF41
DF41
S11556
S11556
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies