Top » Catalog » SNPs » A24925

$19.00

A24925
[A24925]

A24925
hg38 Position: ChrY:11891897..11891897
Ancestral: C
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: J1
Comments: Below ZS7528
Forward Primer: A24925_F CTGTACCCTGTAGCATGATGAGAG
Reverse Primer: A24925_R CATCAAAAGGCATCGGATG
Reviews

Customers who bought this product also purchased
A24911
A24911
BY175370
BY175370
ZS7539
ZS7539
FGC94081
FGC94081
FT386211
FT386211
Z22019
Z22019
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies