Top » Catalog » SNPs » S21118

$18.00

S21118
[S21118]

S21118
hg38 Position: ChrY:16532091..16532091
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2
Comments: Below L38 > S24121
Forward Primer: S21118_F GAATACTTGCAAGTACAATGGTGTTG
Reverse Primer: S21118_R TTTTATTACGTAATTATTGGTAGTCCATATTAAG
Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies