Top » Catalog » SNPs » FGC5939.1

$18.00

FGC5939.1
[FGC5939.1]

FGC5939.1
hg38 Position: ChrY:14341782..14341782
Ancestral: C
Derived: T
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Found in a J2-L229 person
Forward Primer: FGC5939_F GCTATTAATAAATCTAAGGCCCTCCA
Reverse Primer: FGC5939_R CACAACCATTAATGCAGCCAT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies