Top » Catalog » SNPs » Z8424

$18.00

Z8424
[Z8424]

Z8424
hg38 Position: ChrY:7048640..7048640
Ancestral: T
Derived: C
Reference: Ray Banks (2015)
ISOGG Haplogroup: J2b
Comments: Below Z1043. Approximate with Z8425
Forward Primer: Z8424_F TTTGCAGTCCTGTGTATCTAAACG
Reverse Primer: Z8424_R AATTCTCTTCAAAATGTAAATAAATATATGGTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies