Top » Catalog » SNPs » Z8424

$18.00

Z8424
[Z8424]

Z8424
hg38 Position: ChrY:7048640..7048640
Ancestral: T
Derived: C
Reference: Ray Banks (2015)
ISOGG Haplogroup: J2b
Comments: Below Z1043. Approximate with Z8425
Forward Primer: Z8424_F TTTGCAGTCCTGTGTATCTAAACG
Reverse Primer: Z8424_R AATTCTCTTCAAAATGTAAATAAATATATGGTC
Reviews

Customers who bought this product also purchased
BY68757
BY68757
Z1295
Z1295
Y146109
Y146109
Z1043
Z1043
PH1553
PH1553
B440
B440
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies