Top » Catalog » SNPs » HU683

$19.00

HU683
[HU683]

HU683
hg38 Position: ChrY:15169632..15169632
Ancestral: C
Derived: T
Reference: Faleh Al-Hujailan (2020)
ISOGG Haplogroup: J1a
Comments: Below FGC2
Forward Primer: HU683_F AGGTCAGTGTCCATCTAGTCAGTG
Reverse Primer: HU683_R AAACACTTGTTAATTTCGAAGAAAATG
Reviews

Customers who bought this product also purchased
A27207
A27207
Y33889
Y33889
BY4
BY4
Y368170
Y368170
Y33888
Y33888
FT279106
FT279106
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies