Top » Catalog » SNPs » ZS8506

$18.00

ZS8506
[ZS8506]

ZS8506
hg38 Position: ChrY:15454061..15454061
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1
Comments: Below FGC11 > Y4348 > ZS8508
Forward Primer: ZS8506_F GCATGGCTATGTGCAAATTC
Reverse Primer: ZS8506_R GGCTTCACAGATCTGTAAACCTTC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
FGC1705
FGC1705
FGC1707
FGC1707
Y9272
Y9272
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies