Top » Catalog » SNPs » YP276

$18.00

YP276
[YP276]

YP276
hg38 Position: ChrY:14415241..14415241
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1a1a1b1a3a1a
Comments: Aka FGC11904 Phyloequivalent to L176.1
Forward Primer: FGC11904_F TCATGTTATATATAGCAAACTATAAGGCTGA
Reverse Primer: FGC11904_R CGCATGATTTAGCTAGGAATGTG
Reviews

Customers who bought this product also purchased
Z282
Z282
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
L145
L145
BY30614
BY30614
M343
M343
Y129904
Y129904
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies