Top » Catalog » SNPs » YP276

$18.00

YP276
[YP276]

YP276
hg38 Position: ChrY:14415241..14415241
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1a1a1b1a3a1a
Comments: Aka FGC11904 Phyloequivalent to L176.1
Forward Primer: FGC11904_F TCATGTTATATATAGCAAACTATAAGGCTGA
Reverse Primer: FGC11904_R CGCATGATTTAGCTAGGAATGTG
Reviews

Customers who bought this product also purchased
Z91
Z91
Z834
Z834
Y2395
Y2395
M9
M9
Z282
Z282
Y83617
Y83617
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies