Top » Catalog » SNPs » Z2571

$18.00

Z2571
[Z2571]

Z2571
hg38 Position: ChrY:20914229..20914229
Ancestral: C
Derived: G
Reference: Y DNA community
ISOGG Haplogroup: R1b1a1a2a1a2a6
Comments: Downstream of R1b-DF27
Forward Primer: Z2571_F TCAGAAGAAATGAAAGTGATGGG
Reverse Primer: Z2571_R GTCTCTTCATAGAAAGGGAAGCAC
Reviews

Customers who bought this product also purchased
BY21078
BY21078
A16656
A16656
BY31431
BY31431
FGC11380
FGC11380
CTS11567
CTS11567
Y24801
Y24801
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies