Top » Catalog » SNPs » Z2571

$18.00

Z2571
[Z2571]

Z2571
hg38 Position: ChrY:20914229..20914229
Ancestral: C
Derived: G
Reference: Y DNA community
ISOGG Haplogroup: R1b1a1a2a1a2a6
Comments: Downstream of R1b-DF27
Forward Primer: Z2571_F TCAGAAGAAATGAAAGTGATGGG
Reverse Primer: Z2571_R GTCTCTTCATAGAAAGGGAAGCAC
Reviews

Customers who bought this product also purchased
M172
M172
M96
M96
Y189528
Y189528
M267
M267
Y36421
Y36421
Z2103
Z2103
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies