Top » Catalog » SNPs » Z2571

$18.00

Z2571
[Z2571]

Z2571
hg38 Position: ChrY:20914229..20914229
Ancestral: C
Derived: G
Reference: Y DNA community
ISOGG Haplogroup: R1b1a1a2a1a2a6
Comments: Downstream of R1b-DF27
Forward Primer: Z2571_F TCAGAAGAAATGAAAGTGATGGG
Reverse Primer: Z2571_R GTCTCTTCATAGAAAGGGAAGCAC
Reviews

Customers who bought this product also purchased
P312
P312
L51
L51
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
L21
L21
U152
U152
CTS3919
CTS3919
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies