Top » Catalog » SNPs » Z2571

$18.00

Z2571
[Z2571]

Z2571
hg38 Position: ChrY:20914229..20914229
Ancestral: C
Derived: G
Reference: Y DNA community
ISOGG Haplogroup: R1b1a1a2a1a2a6
Comments: Downstream of R1b-DF27
Forward Primer: Z2571_F TCAGAAGAAATGAAAGTGATGGG
Reverse Primer: Z2571_R GTCTCTTCATAGAAAGGGAAGCAC
Reviews

Customers who bought this product also purchased
BY148847
BY148847
BY152326
BY152326
A11625
A11625
BY129286
BY129286
A11632
A11632
BY16029
BY16029
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies