Top » Catalog » SNPs » CTS5396

$18.00

CTS5396
[CTS5396]

CTS5396
hg38 Position: ChrY:14138346..14138346
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1b
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS5396_F CCTCATGTGACAACCATGAGAC
Reverse Primer: CTS5396_R GGATTCCAAGGCCAATAATTC
Reviews

Customers who bought this product also purchased
S764
S764
FGC3213
FGC3213
FGC11134
FGC11134
DF21
DF21
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
Y2890
Y2890
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies