Top » Catalog » SNPs » FT134838

$18.00

FT134838
[FT134838]

FT134838
hg38 Position: ChrY:20050253..20050253
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT134838_F GGTAAAGGGATCAATCCAGTAAGG
Reverse Primer: FT134838_R CACTGAATTAAATTAATTTGATAGGACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x YSEQ-Delta
1 x HVR1
1 x mtComplete
1 x mtUpgrade
1 x HVR2
$405.00
Haplogroup Info
Other products
Currencies