Top » Catalog » SNPs » FT287895

$18.00

FT287895
[FT287895]

FT287895
hg38 Position: ChrY:8816614..8816614
Ancestral: C
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT287895_F AAAATAGAGCAAGTTTAAATTGGTAGTTG
Reverse Primer: FT287895_R GTAGAGTAAGCAGATGATTATTAACCATCTATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x YSEQ-Delta
1 x HVR1
1 x mtComplete
1 x mtUpgrade
1 x HVR2
$405.00
Haplogroup Info
Other products
Currencies