Top » Catalog » SNPs » A27141

$18.00

A27141
[A27141]

A27141
hg38 Position: ChrY:21358049..21358049
Ancestral: A
Derived: G
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: Below FGC1713 > Y16746
Forward Primer: A27141_F GATCAACAAAATTGATAGGCCA
Reverse Primer: A27141_R CAAAGTTCTTTTCTGCATCTATTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies