Top » Catalog » SNPs » FT340310

$18.00

FT340310
[FT340310]

FT340310
hg38 Position: ChrY:21244615..21244615
Ancestral: T
Derived: C
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT340310_F CTTTTCTGGGGCCCACG
Reverse Primer: FT340310_R GAATTACCAGATAGATATCAAGGACTCTTATC
Reviews

Customers who bought this product also purchased
FT336149
FT336149
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies