Top » Catalog » SNPs » A23661

$18.00

A23661
[A23661]

A23661
hg38 Position: ChrY:20570215..20570215
Ancestral: G
Derived: T
Reference: YSEQ (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A23661_F GCAAGAGATTTCTCGGCATC
Reverse Primer: A23661_R AGAGACCATCCCCTGGAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies