Top » Catalog » SNPs » L513

$18.00

L513
[L513]

L513
hg38 Position: ChrY:7472409..7472409
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1b
Comments: Likely R-L21 (From the 1000 Genomes Project data)
Forward Primer: L513_F CACAGCAGGCGGTGAGTAGCG
Reverse Primer: L513_R AGCCTTCTCCATGGTCACGCTGA
Reviews

Customers who bought this product also purchased
Y2890
Y2890
CTS5396
CTS5396
L1065
L1065
FGC32846
FGC32846
BY246
BY246
A2070
A2070
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies