Top » Catalog » SNPs » L513

$18.00

L513
[L513]

L513
hg38 Position: ChrY:7472409..7472409
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1b
Comments: Likely R-L21 (From the 1000 Genomes Project data)
Forward Primer: L513_F CACAGCAGGCGGTGAGTAGCG
Reverse Primer: L513_R AGCCTTCTCCATGGTCACGCTGA
Reviews

Customers who bought this product also purchased
A5411
A5411
L159.2
L159.2
Y22342
Y22342
M269
M269
A2121
A2121
A194
A194
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies