Top » Catalog » SNPs » L513

$18.00

L513
[L513]

L513
hg38 Position: ChrY:7472409..7472409
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1b
Comments: Likely R-L21 (From the 1000 Genomes Project data)
Forward Primer: L513_F CACAGCAGGCGGTGAGTAGCG
Reverse Primer: L513_R AGCCTTCTCCATGGTCACGCTGA
Reviews

Customers who bought this product also purchased
L2
L2
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
A10641
A10641
A12590
A12590
P312
P312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies