Top » Catalog » SNPs » PF5174

$18.00

PF5174
[PF5174]

PF5174
hg38 Position: ChrY:8663540..8663540
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a1a2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF5174_F CAAGTGGCAGTTCTCCAATG
Reverse Primer: PF5174_R TTACCAGGCAAAATGCCAAC
Reviews

Customers who bought this product also purchased
L26
L26
PF5172
PF5172
J2-M172 Superclade Panel
J2-M172 Superclade Panel
J2a-PF5197 Panel
J2a-PF5197 Panel
PF5183
PF5183
PF5197
PF5197
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies