Top » Catalog » SNPs » Y161127

$18.00

Y161127
[Y161127]

Y161127
hg38 Position: ChrY:8976093..8976093
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: E1b
Comments: Below V12 > V32 > Z809
Forward Primer: Y161127_F CAGGTACCTGCCACCACAG
Reverse Primer: Y161127_R CATGAAGCATTCTCTATGGTTTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies