Top » Catalog » SNPs » Y167398

$18.00

Y167398
[Y167398]

Y167398
hg38 Position: ChrY:16770722..16770722
Ancestral: G
Derived: C
Reference: YFull (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y167398_F TATCTAACCATTAGGCTTCCTTAAACA
Reverse Primer: Y167398_R TGTTCTTTTCACCTTACTCCTATTTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies