Top » Catalog » SNPs » Z16500

$18.00

Z16500
[Z16500]

Z16500
HG19 Position: ChrY:15569776..15569776
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1n
Comments: downstream of DF13
Forward Primer: Z16500_F GTGGGGGAAAGGAAGGTATC
Reverse Primer: Z16500_R CTTGGACTTAAACCAGAGGTGAG
Reviews

Customers who bought this product also purchased
PH367
PH367
S764
S764
A5919
A5919
S744
S744
FGC10125
FGC10125
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies