Top » Catalog » SNPs » Z16500

$18.00

Z16500
[Z16500]

Z16500
HG19 Position: ChrY:17681656..17681656
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1
Comments: downstream of DF13
Forward Primer: Z16500_F GTGGGGGAAAGGAAGGTATC
Reverse Primer: Z16500_R CTTGGACTTAAACCAGAGGTGAG
Reviews

Customers who bought this product also purchased
L1065
L1065
S691
S691
PH367
PH367
S764
S764
A5919
A5919
S744
S744
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies