Top » Catalog » SNPs » Z16500

$18.00

Z16500
[Z16500]

Z16500
hg38 Position: ChrY:15569776..15569776
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1n
Comments: downstream of DF13
Forward Primer: Z16500_F GTGGGGGAAAGGAAGGTATC
Reverse Primer: Z16500_R CTTGGACTTAAACCAGAGGTGAG
Reviews

Customers who bought this product also purchased
Z17969
Z17969
FGC42169
FGC42169
FGC30631
FGC30631
BY11922
BY11922
U152
U152
DF19
DF19
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies