Top » Catalog » SNPs » FT180653

$18.00

FT180653
[FT180653]

FT180653
hg38 Position: ChrY:14230832..14230832
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below FGC1713 > ZS11617
Forward Primer: FT180653_F CCAGTCTGGGTGAAAGTGAGAC
Reverse Primer: FT180653_R TCAAAAACACTGAGTAGTAACTGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies