Top » Catalog » SNPs » FT309464

$18.00

FT309464
[FT309464]

FT309464
hg38 Position: ChrY:15497204..15497204
Ancestral: C
Derived: A
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: Below S691 > CTS4554
Forward Primer: FT309464_F CCAAGGAAAATTTTATTTTAACGTCA
Reverse Primer: FT309464_R CTGACATTGTCGCCTTTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies