Top » Catalog » SNPs » FT309899

$18.00

FT309899
[FT309899]

FT309899
hg38 Position: ChrY:19914045..19914045
Ancestral: C
Derived: G
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: Below S691 > CTS4554
Forward Primer: FT309899_F CCTAGCCAGGCCAAAGAAC
Reverse Primer: FT309899_R CATTAGGAATTAATTCCATCCTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies