Top » Catalog » SNPs » A27503

$18.00

A27503
[A27503]

A27503
hg38 Position: ChrY:14315681..14315681
Ancestral: A
Derived: C
Reference: Xin Lu (2020)
ISOGG Haplogroup: O
Comments: Below Y26385
Forward Primer: A27503_F AGGGGACATGGAAAACTTCA
Reverse Primer: A27503_R AAAAAAAAGAAGATAGTGATATGTCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies