Top » Catalog » SNPs » Y199088

$18.00

Y199088
[Y199088]

Y199088
hg38 Position: ChrY:17013202..17013202
Ancestral: A
Derived: G
Reference: YFull (2020)
ISOGG Haplogroup: I1
Comments: Below P109 > FGC33034
Forward Primer: Y199088_F AACTTTCTTGTATCCTCCAATATATGC
Reverse Primer: Y199088_R CTGGGACTACAGGCGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies