Top » Catalog » SNPs » FT30534

$18.00

FT30534
[FT30534]

FT30534
hg38 Position: ChrY:15339628..15339628
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below Y5322 > Y8975 > FGC11743
Forward Primer: FT30534_F CTTTCTCTGTCTGTATTTGACTACATTTC
Reverse Primer: FT30534_R CTACAAACACTTCTATGCAAATAAACTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies