Top » Catalog » SNPs » CTS9416

$18.00

CTS9416
[CTS9416]

CTS9416
hg38 Position: ChrY:16768206..16768206
Ancestral: T
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a2
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS9416_F GAAGGGGAACTTCACTCACTTG
Reverse Primer: CTS9416_R ATGGCATCCCTGTACCTGAG
Reviews

Customers who bought this product also purchased
Y33200
Y33200
M198
M198
BY251
BY251
Y38317
Y38317
L664
L664
CTS9219
CTS9219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies