Top » Catalog » SNPs » Y24532

$18.00

Y24532
[Y24532]

Y24532
hg38 Position: ChrY:15923515..15923515
Ancestral: T
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y24532_F CTGAATAGATGTAATCACCTGTGTTAATC
Reverse Primer: Y24532_R AAAGAAAAGAGAACACTTACACAGTATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies