Top » Catalog » SNPs » A27505

$18.00

A27505
[A27505]

A27505
hg38 Position: ChrY:7546741..7546741
Ancestral: A
Derived: C
Reference: YSEQ (2020)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A27505_F AGTTAAGCATTCTCAAATGTCAGATG
Reverse Primer: A27505_R TGAATAGTCATGCAGGCTTACG
Reviews

Customers who bought this product also purchased
A27504
A27504
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies