Top » Catalog » SNPs » S4813

$18.00

S4813
[S4813]

S4813
hg38 Position: ChrY:18990976..18990976
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: not listed
Comments: .
Forward Primer: S4813v2_F CAGTAGCTTCAAAACGGTTCG
Reverse Primer: S4813v2_R ACAACTATGGATCAGAATAGCCAC
Reviews

Customers who bought this product also purchased
A266
A266
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies