Top » Catalog » SNPs » Z2103

$18.00

Z2103
[Z2103]

Z2103
hg38 Position: ChrY:7318094..7318094
Ancestral: G
Derived: C
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2
Comments: downstream of L150; parallel to L51
Forward Primer: Z2103v3_F AGTTCCCCGTTTATAAGTGCC
Reverse Primer: Z2103v3_R GCACCCAGCCTATTTTCATG
Reviews

Customers who bought this product also purchased
Y33200
Y33200
Y36979
Y36979
Y34174
Y34174
M172
M172
Y31385
Y31385
Z2571
Z2571
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies