Top » Catalog » SNPs » Z2103

$18.00

Z2103
[Z2103]

Z2103
hg38 Position: ChrY:7318094..7318094
Ancestral: G
Derived: C
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2
Comments: downstream of L150; parallel to L51
Forward Primer: Z2103v3_F AGTTCCCCGTTTATAAGTGCC
Reverse Primer: Z2103v3_R GCACCCAGCCTATTTTCATG
Reviews

Customers who bought this product also purchased
Y23493
Y23493
BY20218
BY20218
BY251
BY251
Y28788
Y28788
A20329
A20329
Y19971
Y19971
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies