Top » Catalog » SNPs » Z2103

$18.00

Z2103
[Z2103]

Z2103
hg38 Position: ChrY:7318094..7318094
Ancestral: G
Derived: C
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2
Comments: downstream of L150; parallel to L51
Forward Primer: Z2103v3_F AGTTCCCCGTTTATAAGTGCC
Reverse Primer: Z2103v3_R GCACCCAGCCTATTTTCATG
Reviews

Customers who bought this product also purchased
PF6307
PF6307
Y264746
Y264746
A24000
A24000
FTA11089
FTA11089
Y177890
Y177890
Y63957
Y63957
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies