Top » Catalog » SNPs » Z2103

$18.00

Z2103
[Z2103]

Z2103
hg38 Position: ChrY:7318094..7318094
Ancestral: G
Derived: C
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2
Comments: downstream of L150; parallel to L51
Forward Primer: Z2103v3_F AGTTCCCCGTTTATAAGTGCC
Reverse Primer: Z2103v3_R GCACCCAGCCTATTTTCATG
Reviews

Customers who bought this product also purchased
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF19
DF19
L21
L21
DF99
DF99
Y113338
Y113338
L513
L513
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies